;;; -*- outline -*-   Big Bad FTP List

<(Return to Top Level)>				C-c C-s to show the full entry
<(Cut Out All But Topic Headers)>		C-c C-h hide the subentries
<(Frequent FTP Sites)>				C-h m for extensive help


<(Click Here to Add a New Site to this List)>


* 	Local Sites
**** 	"/anonymous@ncube10.csee:"
**** 	"/tb06@pl118g.cc.lehigh.edu:"
**** 	"/tb06@pl118f.cc.lehigh.edu:"
**** 	"/tb06@pl118e.cc.lehigh.edu:"
**** 	"/tb06@pl118d.cc.lehigh.edu:"
**** 	"/tb06@pl118c.cc.lehigh.edu:"
**** 	"/tb06@pl118b.cc.lehigh.edu:"
**** 	"/tbrannon@pmatlab5.csee:"
**** 	"/anonymous@klotho.cs.caltech.edu:"



<(Back to Top)>

<(Brand New HyperActive Site Listings)>


<(Tom Czarnik's FTP List)> ;;; eventally perl this to HyperActive
			   ;;; format so all the Hyperchondriacs can
			   ;;; view it
	

*	HP48sx
** 	Lots of stuff for the HP48sx
***
****	"/anonymous@seq.uncwil.edu:hp48"

*    Latest Web2c (for TeX)
**   {web,web2c}-<version>.tar.Z
***  Latest version of Web2c changed every Sunday night.
     This host is in Germany, Europe -- not in the USA!
**** "/anonymous@ftp.th-darmstadt.de:pub/tex/src/web2c

*	faces bitmaps and the like
**
***
****	"/anonymous@iuvax.cs.indiana.edu:/pub/faces/"

*    TeX (transfig)
**   pub/transfig*.tar.Z
***  Contains the sources for the figure translation package for TeX, including
fig2dev.
**** "/anonymous@ftp.cs.cornell.edu:pub"

*    TeX/GIF/Animation/IEEE style file
**   
***  
**** "/anonymous@wpi.wpi.edu:"

*    XGobi
**   general
***  Dynamic scatter plotting graphics package for exploratory data analysis.
 email: statlib@temper.stat.cmu.edu with message "send xgobi from general"
**** "/statlib@lib.stat.cmu.edu:general"

*     Project Gutenberg
**   etext/*
***  Public Domain Etexts. The primary goal of Project Gutenberg is 
to encourage the creation and distribution of electronic text.
**** "/anonymous@mrcnext.cso.uiuc.edu:"

*    LaTeX/Postscript (Boxed eps)
**   pub/siebenmann/*
***  Boxed postscript filr inclusions in LaTeX. Supports OzTeX. 
IP 130.84.128.100
**** "/anonymous@rsovax.ups.circe.fr:"


* 	How can I include a PostScript figure in LaTeX?/LaTeX/Postscript
** 	psfig
*** 	<(Describe psfig)>
**** 	"/anonymous@whitechapel.media.mit.edu:"
 	"/anonymous@linc.cis.upenn.edu:"
 	"/anonymous@ymir.claremont.edu:"

*    Xtank/Sun Sparcstation Sounds
**   pub/xtank/xtank1.3d.tar.Z
***  The directory contains the tar'd sources for a great X11 multiplayer game.
There is a README file in there.
**** "/anonymous@ftp.eng.umd.edu:"


*    Rc
**   Rc
***  Here is always the latest version of the Rc shell. Rc is a Unix implementation of the Bell labs Plan 9 shell.
**** "/anonymous@archone.tamu.edu:/pub/rc"


* 	Threads/Unix Programming/Control Flow/Pre-Emptive Threads for Sparcs
** 	Portable Common Runtime package (pcr)
***	
****	"/anonymous@arisia.xerox.com:/pub/pcr"

* 	GNU/Free Software Foundation/Richard Stallman/Emacs
** 	GNU Emacs FAQ
***	
****	"/anonymous@rtfm.mit.edu:pub/usenet/news.answers/GNU-Emacs-FAQ/"


<(Back to Top)>

*	Embedded Extensible Language
**	Tcl/Tk
****	"/anonymous@allspice.berkeley.edu:"
****	"/anonymous@ftp.uu.net:/languages"
**	Basic Object System
****	"/anonymous@monch.edrc.cmu.edu:/usr0/snl/archive"
**	porthole geometry manager
****	"/anonymous@ajk.tele.fi:/pub/tcl+tk"

*	Programming Language/Oberon
***	a technical document is available from:
****	"/anonymous@princeton.edu:pub/oberon/oberon.tex"

*	Sockets
*** Tutorial
"/anonymous@130.59.1.40:/docs/papers/BSD_IPC_Tutorial" ;; nic.switch.edu
;; src.doc.ic.ac.uk
*** 
"/anonymous@146.169.2.1:/usenet/comp.archives/auto/comp.lang.ada 
*** sockettool.tar.Z
"/anonymous@140.221.10.1:/pub/pdetools" - 	


* 	ls-LR Section
** 
	The purpose of this section is to allow you to view the archive files
	for major internet ftp sites. Email me to add your favorites. 

	ftp.win.tue.nl 		<(a 300k transfer)>
	gatekeeper.dec.com: 	<(by name)>  <(by time)>  a 666k transfer 
	ftp.uu.net:		<(master index)>  
	"/anonymous@trantor.harris-atd.com:" <(Trantor Directory Index)>

* 	Operating Systems
** 	BSD386
***	BSD for the 386
**** 	"/anonymous@tesla.ee.cornell.edu:"

*	Languages / Smalltalk FAQ
**	<(Smalltalk FAQ)>

* 	List of European Consulting Firms
****	"/anonymous@ursa-major.spdcc.com:"

* 	Computer Music
**	MIT Csound
***	Construct music for many many workstations, excellent package
**** 	"/anonymous@ems.media.mit.edu:"

*	
	GNU Software / Free Software Foundation / Richard M. Stallman
** 	<(List of GNU Software)>
	<(Ordering GNU Software)>
	<(What Hardware does GNU Software Run On?)>
	<(How do I get support services for GNU Software?)>
	<(Terms of Using GNU Software)>
GNU Software Archive Sites
  	Note: please try to use these sites first. They are mirrored daily
	from prep.ai.mit.edu and tend to have less of a system load. Thanks.
 	"/anonymous@ftp.tue.win.nl:"	"/anonymous@ftp.tue.win.nl:pub/gnu"
	"/anonymous@src.doc.ic.ac.uk:"	"/anonymous@src.doc.ic.ac.uk:pub/gnu"
 	"/anonymous@prep.ai.mit.edu:"	"/anonymous@prep.ai.mit.edu:pub/gnu"
	"/anonymous@sh.cs.net:" "/anonymous@mcsun.eu.net:"
GNU Prototyping Site
	a good introduction to elisp is here as well as GNUmach and other stuff 	they are working on 
	"/anonymous@alpha.gnu.ai.mit.edu:"
Emacs Lisp Archive
	<(Guidelines For Posting to the Archive)>
	<(View Database of Emacs Lisp Source Code)>
	"/anonymous@archive.cis.ohio-state.edu:pub/gnu/emacs/elisp-archive"
	"/anonymous@tutserver.tut.ac.jp:"
Ange-FTP - transparent FTP support for Emacs file routines
	Mailing List Archive 	"/anonymous@ftp.reed.edu:"
	Most Recent Version	"/anonymous@alpha.gnu.ai.mit.edu:"

* 	Parallel Computing
** 	Ease
*** 	Parallel language which allows context sharing
**** 	"/anonymous@isatis.ensmp.fr:"
 
* 	Parallel Computing
** 	distr_os
*** 	List of distributed systems and operating systems
**** 	"/anonymous@titania.mathematik.uni-ulm.de:"

* 	Computer Graphics/X Windows
** 	SPHIGS
***	Simple Hierarchical Interactive Graphics 
**** 	"/anonymous@wilma.cs.brown.edu:"
	"/anonymous@wuarchive.wustl.edu:"

* 	Computer Graphics/X Windows
** 	SRGP
*** 	Simple Raster Graphics Package
**** 	"/anonymous@wilma.cs.brown.edu:"
	"/anonymous@wuarchive.wustl.edu:"


* 	X Windows / comp.sources.x archive
	<(View all files archived from comp.sources.x)>
	"/anonymous@j.cc.purdue.edu:comp.sources.x"

*	Framemaker Clip Art and Images
****	"/anonymous@trantor.harris-atd.com:" <(Trantor Directory Index)>

* 	C++ Class Libraries
** 	NIHCL for g++
*** 	140.174.1.1 is IP address
**** 	"/anonymous@cygnus.com:"

* 	Environment/Global Warming/Third World
** 	Tiempo Newsletter
*** 	pub/ECIX
**** 	"/anonymous@igc.org:"

* 	Music
** 	Csound
*** 	
**** 	"/anonymous@ems.media.mit.edu:"

* 	TeX
** 	LaTeX styles
*** 	directory of latex styles
**** 	"/anonymous@fionavar.mit.edu:"
**	troff to latex
**** 	"/anonymous@137.226.112.31:/pub/textproc/TeX"
**	<(TeX/LaTeX Frequently Asked Questions)>
	<(TeX/LaTeX Frequently Asked Questions Supplement)>

* 	Women Computer Scientists/Robotics
** 	Women Computer Scientists/Reactive Robotics
*** 	pub/ellens/womcs*.ps
**** 	"/anonymous@ftp.ai.mit.edu:"

* 	X-Windows
*** 	x-source-list.Z contains X-win ftp sites. dir: contrib
**** 	"/anonymous@export.lcs.mit.edu:"
 	"/anonymous@giza.cis.ohio-state.edu:" (mirror site)

* 	Phone Phreaking / Hacking
** 	Phrack
*** 	Phrack is in cud . all kinds of hacker stuff from back in the days
**** 	"/anonymous@192.88.144.4:"  ;; ftp.eff.org


* 	Prose/Ethnic Tex
** 	Poorman's TeX/Translation of John Trevisa from Latin
**** 	"/anonymous@blackbox.hacc.washington.edu:"

* 	TeX
**** 	"/anonymous@byron.u.washington.edu:"
 	"/anonymous@june.cs.washington.edu:"

* 	Ethnic TeX
** 	chinese.tar.Z
*** 	
**** 	"/anonymous@ftphost.cac.washington.edu:"

* 	Public Domain Scientific Software available from Netlib
*** 	<(Describe Netlib)>


* 	Statistics
*** 	To get started using StatLib, send the one line message
	send index to statlib@lib.stat.cmu.edu
**** 	"/statlib@lib.stat.cmu.edu:"

* 	Logic
** 	HigherOrderLogic Theorem Prover (hol)
*** 	
**** 	"/anonymous@ted.cs.uidaho.edu:pub"

* 	Computer Graphics
** 	Gif Viewer for PC's
*** 	pub/pc
**** 	"/anonymous@wolfen.cc.uow.edu.au:"

* 	Ethnic Tex
** 	Bejing-24.bdf/PinYin pronunciation tables/Pinyin->GB code table/Best of comp.graphics/World Map/Zhongwen 
**** 	"/anonymous@hanauma.stanford.edu:"

* 	Ethnic Tex
** 	ChTeX Modified
**** 	"/anonymous@neon.stanford.edu:"

* 	Postscript
** 	Episode Viewer
**** 	"/anonymous@lurch.stanford.edu:"

* 	ADA/TeX
** 	Annotated ADA
*** 	Sriram Sankar's ada macros for TeX..
**** 	"/anonymous@anna.stanford.edu:"

* 	TeX
** 	dvips
*** 	quasi-official repository for TeX and related toys
**** 	"/anonymous@labrea.stanford.edu:"

* 	Gcc Hacks/Gcc for 68k
**	Gcc 68k
*** 	pub/GNU for docs and binaries from marc@sun-valley.stanford.edu Sat Nov 16 23:40:10 1991 
**** 	"/anonymous@sun-valley.stanford.edu:"

* 	Object-Oriented Graphics
** 	Interviews
*** 	home of Interviews, an object-oriented windowing system
**** 	"/anonymous@interviews.stanford.edu:"

* 	Editors/TeX/Gifs
** 	Gifs/Unix-TECO/TeXtyl
*** 	TeXtyl allows postprocessing with any available fonts
**** 	"/anonymous@venus.ycc.yale.edu:"

* 	Mathematics
** 	Mathematical Abstracts Database
*** 	<(Describe the Abstracts Database)>
**** 	"/anonymous@yalevm.ycc.yale.edu:"

* 	Graphics/Ray Tracing
** 	Utah Raster Toolkit
**** 	"/anonymous@weedeater.math.yale.edu:"

* 	Spell Check
** 	Ispell
**** 	"/anonymous@bulldog.cs.yale.edu:"

* 	Ethnic Tex
** 	ChTeX
*** 	mirror site for Ethnic Typographic/TeX things
**** 	"/anonymous@kth.se:"

* 	IBM
** 	Hytelnet4.0
*** 	A utility which gives an IBM-PC user instant-access to all Internet-accessible library  catalogs, Freenets, CWISs, Library BBSs, etc.  
**** 	"/anonymous@vaxb.acs.unt.edu:"

* 	Ray Tracing/Graphics
** 	MicroEmacs/VT100 Art/Kermit Docs/Zoo Archiver
**** 	"/anonymous@irisa.irisa.fr:"

* 	Ethnic Tex
** 	ArabTeX
*** 	Home of ArabTeX
**** 	"/anonymous@ifi.informatik.uni-stuttgart.de:"

* 	X Games
** 	Xpipeman
*** 	Xpipeman is an addictive strategy game
**** 	email to pavern@uk.ac.man.cs

* 	Ethnic TeX/Chinese Metafonts
** 	Arabic/Japanese/Korean/ChTeX/ArabTeX
*** 	lots of language and tex-related stuff.
**** 	"/anonymous@kythera.nmsu.edu:"

* 	Ethnic Tex
** 	Duke Chinese Typist
**** 	"/anonymous@msdos.archive.umich.edu:"

** 	ParaGraph
**** 	"/anonymous@bull.cs.williams.edu:"

* 	comp.sources.unix/TeX/Bitmaps/Games/Graphics
** 	Bitmaps/comp.sources.unix/wp2latex/CommonTeX2.9/ckermit/Uemacs_3.10/UC-Berkeley Software Catalog
**** 	"/anonymous@ccb.ucsf.edu:"

* 	NSF-Japan/Software Development/Pnrogramming Languages/SB-Prolog
** 	NSF-Japan/SB-Prolog/Japanese Computer Science Info/Scorpion
Software Development System/SR Programming Language/Janus Programming
Language/Icon Programming Language/Xkernel/Agrep/Anrep  
**** 	"/anonymous@cs.arizona.edu:"

* 	Graphics
** 	Star Gifs/Ray Tracing
**** 	"/anonymous@iear.arts.rpi.edu:"

* 	LISP/Logic
** 	thm (theorem prover)/Kyoto Common Lisp
**** 	"/anonymous@rascal.ics.utexas.edu:"

* 	TeX
** 	Fig/TransFig
**** 	"/anonymous@ftp.cs.cornell.edu:"

*	Parallel Computing
**	Oasis
***	<(Description)>
****	"/anonymous@141.212.99.7:oasis" ;; z.eecs.umich.edu

* 	Parallel Computing Environment
** 	Paragon Parallel Programming Environment
*** 	<(Paragon Information)>
**** 	"/anonymous@tesla.ee.cornell.edu:"

* 	Parallel Computing
** 	Parallel Virtual Machine
*** 	PVM (parallel virtual machine) is a software
package which allows the utilization for a heterogeneous network of
computers.
**** 	"/anonymous@cs.utk.edu:"

* 	Protein Primary Structure
** 	ProfileGraph
**** 	"/anonymous@nic.funet.fi:"
	"/anonymous@menudo.uh.edu:"


* 	Drosophila Genetic Map/Protein Primary Structure
** 	ProfileGraph/FlyBase (Drosophila)
*** 	
**** 	"/anonymous@ftp.bio.indiana.edu:"

* 	Restriction Enzyme Dbase/Cold Spring Harbor
** 	Cold Spring Harbor restriction enzyme database
*** 	The data are contained in the file type2.lst and
literature references are in references.lst.  Questions about the
database should be directed to Dr. Roberts at roberts@cshl.org.

                                Dave Kristofferson
                                GenBank Manager
                                kristoff@genbank.bio.net
**** 	"/anonymous@karyon.bio.net:pub/db"

* 	Games
**** 	"/anonymous@decuac.dec.com:"

* 	Biology
** 	Biology
*** 	<(Setup of bioftp.unibas.ch)>
**** 	"/anonymous@bioftp.unibas.ch:"

* 	Medical Information
** 	Datafile of Biological Scientists
*** 	<(Important for all Biological Scientists)>
**** 	"/anonymous@lhc.nlm.nih.giv:"

* 	Medical Information
** 	Eukaryotic Promoter Database
*** 	./repository/EPD
**** 	"/anonymous@ncbi.nlm.nih.gov:"

*	Recipes/Games/comp.sources.games/comp.sources.misc/comp.sources.sun/comp.sources.unix  
** 	c++2latex/shX
*** 	comp.sources.misc
**** 	"/anonymous@gatekeeper.dec.com:"

* 	TeX
** 	TeXPS
**** 	"/anonymous@arthur.cs.purdue.edu:"

* 	Ethnic TeX
** 	cxterm/celvis/cless/cclib16* fonts
**** 	"/anonymous@cs.purdue.edu:"

*	comp.binaries.amiga/comp.sources.amiga/comp.sources.games/comp.sources.sun comp.sources.unix/comp.sources.x/comp.sys.next  
** 	hqx
*** 	
**** 	"/anonymous@j.cc.purdue.edu:"

* 	TeX/Image Compression/Graphics/Ray Tracing
** 	epp2tex/JPEGxeval IMAGE Compression/Utah Raster Toolkit
*** 	epp2tex is a tool which accepts a relatively easy to write file
of estimation results.  It generates a LaTeX table.  It has limited
commandline support for tuning the appearance of the table.
**** 	"/anonymous@ftp.uu.net:"

* 	Programming Language
** 	Fortran2C/Pascal2C/J (programming language)
*** 	<(Describe the Programming Language J)>
**** 	"/anonymous@watserv1.waterloo.edu:"

* 	Ethnic TeX/Latin Font/Cyrillic Font/X-Windows Fonts
** 	KOI-7/8 fonts
*** 	cd to COUP/TL/xkoi-8.7.tar
**** 	"/anonymous@moxie.oswego.edu:"

* 	Pattern Processing/Teco
** 	Teco
*** 	teco is in pub/teco
**** 	"/anonymous@usc.edu:"

* 	C Declaration Parser/Pascal2C/Emacs Calculator
** 	PascaltoC/C Declaration Parser/GnuCalc
*** 	dave gillespies calc adds floating point ops to elisp!
**** 	"/anonymous@csvax.cs.caltech.edu:"

* 	Artificial Intelligence
** 	Artificial Intelligence Lisp Code
*** 	pub/norvig
**** 	"/anonymous@unix.sri.com:"

* 	Graphics
** 	NIH Image 1.19
**** 	"/anonymous@alw.nih.gov:"

* 	Japanese Tutorial
** 	Kanji Guess/Japanese learning aid
*** 	<(Describe Kanji Guess)>
**** 	"/anonymous@monu6.cc.monash.edu.au:pub/Nihongo"



* 	NeXT Software
**** 	"/anonymous@nova.cc.purdue.edu:"

* 	Raster Fonts/MetaFonts
** 	Metafonts
*** 	probably has all the HP fonts in the world
**** 	"/anonymous@mims-iris.waterloo.edu:"

* 	Raster Fonts/MetaFonts
** 	Metafonts
*** 	Raster fonts for Metafont use
**** 	"/anonymous@ctrsci.math.utah.edu:"

* 	Raster Fonts/MetaFonts
** 	Metafonts
*** 	Raster fonts for Metafont use
**** 	"/anonymous@science.utah.edu:"

** 	VMS Gnu Emacs
**** 	"/anonymous@cc.utah.edu:"

* 	Graphics/Ray Tracing/Non-Rational B-Spline Software
** 	Utah Raster Toolkit/NURBS (Non-Uniform Ratl B-Splines)
**** 	"/anonymous@cs.utah.edu:"

* 	Webster
** 	Access Webster
**** 	"/anonymous@ee.ecn.purdue.edu:"

* 	X-Windows/TeX
** 	BDF Fonts/XTeX
*** 	view dvi file within X-Windows
**** 	"/anonymous@foobar.colorado.edu:"

* 	Graphics/TeX to Document C Code (Spiderweb)/Music/Tex
** 	CWEB/WEB/Rayshade 3.0/Rayshade 4.0/Spiderweb
*** 	has next wares AND is primary src for greek fonts for TeX. spiderweb is used to document c code within latex
**** 	"/anonymous@princeton.edu:"

* 	Parallel Computing
** 	Ease
*** 	source code for parallel language ease is here
**** 	"/anonymous@isatis.ensmp.fr:"

* 	Parallel Computing
** 	List of Distributed Systems
*** 	pub/soft/distr_os
**** 	"/anonymous@titania.mathematik.uni-ulm.de:"

* 	Japanese
** 	Nihongo Emacs
**** 	"/anonymous@ftp.cs.titech.ac.jp:"

* 	Sun RPC/NN/xypic
** 	Sun RPC/NN/xypic
*** 	Denmark
**** 	"/anonymous@freja.diku.dk:"

* 	Statistics/Contingency Tables/EM Algorithm/TeX/AUC-TeX
** 	AUC-TeX
*** 	Comprehensive Environment for writing latex files
**** 	"/anonymous@iesd.auc.dk:"

* 	TeX
** 	LaTeX figures
**** 	"/anonymous@hercules.csl.sri.com:"

* 	Mathematics
** 	Theorem Prover
**** 	"/anonymous@herky.cs.uiowa.edu:"

* 	Knowledge Representation
** 	Mobal
*** 	<(View Definition of Mobal)>
**** 	"/anonymous@xpssun.gmd.de:"

* 	X-Windows
** 	MandelSpawn
*** 	in pub/X11/contrib/ms-0.05.tar.Z
**** 	"/anonymous@funic.funet.fi:"

* 	Tex/Graphics/Gifs/Ray Tracing/Radiosity
** 	Astronomical Observatory FITS Viewer/Ray Tracing/Bibliography/Radiosity Bibliography/Salem/CellSim/GraphicsGems/Quickdraw Popi/Ray Tracing News/ColorQuant/DKBTracer/PVRay/DRT/Ohtas Ray Tracer/QRT/RayScene/VORT Ray Tracer/VM-pRAY/Polygon/Processor Sphigs/SRGP/Wave/Sphere/TeXhax digest    
*** 	major TeX archive. has TeXhax digest
**** 	"/anonymous@wuarchive.wustl.edu:"

* 	TeX
** 	ChTex/ArabTeX/Image
*** 	huge directory of styles. including one for the thesis.
**** 	"/anonymous@ftp.ics.osaka-u.ac.jp:"


* 	Natural Language Processing
** 	Text to Phoneme Program
*** 	/pub/linguist/phone.tar.Z
**** 	"/anonymous@ftp.Hawaii.edu:"

* 	Graphics/Ray Tracing
** 	Utah Raster Toolkit
**** 	"/anonymous@nl.cs.cmu.edu:"

* 	Natural Language Processing
** 	English Parser
*** 	/usr/sleator/public
**** 	"/anonymous@spade.pc.cs.cmu.edu:"

* 	ADA
** 	ADA
*** 	All the ADA you could ask for
**** 	"/anonymous@ajpo.sei.cmu.edu:"

* 	Gnu/VMS G++
** 	VMS G++
*** 	Major Gnu Archive
**** 	"/anonymous@mango.miami.edu:"

* 	Chinese News/Chinese Word Processors
** 	Big5->GB/Readnews
*** 	contains a lot of Chinese word processors both for PC's and other
**** 	"/anonymous@ahkcus.org:"

* 	Chinese Chess
** 	Chinese Chess
*** 	
**** 	"/anonymous@cs.ualberta.ca:"

* 	Genealogy
** 	Genealogy
*** 	
**** 	"/anonymous@134.114.64.24:"

* 	Japanese Terminal Emulator
*** 	For the PC, you should use a terminal emulator hterm written by
Hirano-san at Tokyo U if your PC has VGA or EGA.  If your display
adapter is Hercules or CGA (!), then you have to settle with my
KD (kanji driver) + MS-Kermit.  Both of these are free and can
be obtained by anonymous FTP from mindseye.berkeley.edu
[128.32.232.19].  Both supports full JIS-level 2 Japanese
character set (6000+ characters).

If you use regular 'rn' be sure to use a command w | more -f
at the first pause after news header for an article is displayed.

--
Izumi Ohzawa             [ $BBg_78^=;(B ]
USMail: University of California, 360 Minor Hall, Berkeley, CA 94720
Telephone: (510) 642-6440     Fax:  (510) 642-3323
Internet: izumi@pinoko.berkeley.edu (NeXT Mail OK)
**** 	"/anonymous@mindseye.berkeley.edu:"

* 	LISP/Mathematics
** 	Lisp Mathematica (mma)
*** 	mathematica-like system written in Allegro common lisp
**** 	"/anonymous@peoplesparc.berkeley.edu:"



* 	TeX
** 	ChTex/ArabTeX/Image
*** 	contains the addendum to the TeX FAQ in pub/raymond
**** 	"/anonymous@math.berkeley.edu:"

* 	Programming Languages
** 	TCL
*** 	Paper in USENIX 89
**** 	"/anonymous@sprite.berkeley.edu:"

* 	TeX/build an lplain.fmt with to different hyphen-files?
** 	Babel
*** 	

   I get the impression that TeX 3.x supports some sort of a multilingual
   scheme, providing a way to easily swith between languages in the same
   document.

You should look at the Babel system, by Johannes Braams, obtainable by
mail from listserv@hearn.bitnet, listserv@dhdurz1.bitnet,
mail-server@rusinfo.rus.uni-stuttgart.de, or by anonymous ftp from
rusinfo.rus.uni-stuttgart.de [129.69.1.12].

**** 	"/anonymous@rusinfo.rus.uni-stuttgart.de:"

* 	Mathematics
** 	SymbMath
***	<(Extensive Description of SymbMath)>
**** 	"/anonymous@simtel20.army.mil:"

* 	Tex/Raster Fonts/MetaFonts
** 	dvips/dvitops/Web/Cweb/Spiderweb/MusicTeX
*** 	2nd largest tex archive in the WORLD. Aggresively tracks down packages
**** 	"/anonymous@ymir.claremont.edu:"

* 	Ethnic TeX
** 	Cyrillic Fonts
**** 	"/anonymous@hmcvax.claremont.edu:"

* 	<(Perl Freyquently Asked Questions)>
** 	Perl Reference Guide
**** 	"/anonymous@sol.cs.ruu.nl:"
**	Perl Distribution/Source Archive
**** 	"/anonymous@archive.cis.ohio-state.edu:pub/perl"
** 	Perl (MSDOS)
*** 	pub/msdos/perl
**** 	"/anonymous@eeserv.ee.umanitoba.ca:"
***	Perl Manual
****	"/anonymous@128.214.6.100:/pub/languages/perl-manual" ;; nic.funet.fi
***	Perl Manpage
****	"/anonymous@128.83.162.5:/pub/languages/perl-4.019" 
***	Perl Texinfo
****	"/anonymous@128.93.1.26:/lang/perl"
***	Perl Tutorials
****	"/anonymous@128.214.6.100:/pub/languages/perl/convex.com/tutorial "


* 	ChTex/ArabTeX/Image
** 	comp.sources.x
**** 	"/anonymous@schizo.samsun.com:"
* 	TeX/Gifs
** 	ChTex
*** 	[128.252.135.4] ... mirror wmsr-simtel20.army.mil
**** 	"/anonymous@wuarchive.wustl.edu:"

* 	TeX
** 	Image
*** 	[131.170.24.42] ... mirrors labrea for those down under
**** 	"/anonymous@yallara.cs.rmit.oz.au:"

* 	Cscheme
** 	Cscheme 6.2
*** 	includes a GL interface
**** 	"/anonymous@godzilla.cgl.rmit.oz.au:"

* 	Tex
** 	ChTex/ArabTeX/Image
*** 	run by george greenwade, a man on the up and up
**** 	"/anonymous@niord.shsu.edu:"

* 	TeX
** 	TeX/gcc/ghostscript
*** 	TeX, gcc, ghostscript, f2c
**** 	"/anonymous@research.att.com:"

* 	X-Windows/Emacs Hacks
** 	ISO Latin-1 Emacs Mode
*** 	input the ISO Latin-1 character set in a convenient way
**** 	"/anonymous@laas.laas.fr:"

* 	Perl
** 	Perl
**** 	"/anonymous@convex.com:"



* 	X-Windows/Parallel Computing
** 	PCP (parallel language)/AWM X Tutorial
**** 	"/anonymous@maddog.llnl.gov:"

* 	X-Windows
*** 	X11R4
**** 	"/anonymous@lll-crg.llnl.gov:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	GNU X11 comp.sources.unix
**** 	"/anonymous@iraun1.ira.uka.de:"

* 	Rapid Language Prototyping
** 	TXL
*** 	<(Verbose Description of TXL)>
**** 	"/anonymous@qusuna.qucis.queensu.ca:"

* 	X-Windows/Tex
*** 	Karl Berry's font naming scheme v1.0 192.12.26.23 tex/fontname/fontname.texi
**** 	"/anonymous@ftp.cs.umb.edu:"

* 	X-Windows/Sun/Unix
** 	comp.sources.misc/comp.sources.sun/comp.sources.unix
*** 	misc, TeX, X
**** 	"/anonymous@hydra.helsinki.fi:"

* 	hashing
** 	Perfect Hash Generator
**** 	"/anonymous@ics.uci.edu:"



* 	Miscellany/Images
*** 	images, gnu, icon, kermit, and so forth, ghostscript patches
**** 	"/anonymous@extro.ucc.su.oz.au:"

* 	X-Windows
*** 	X applications here
**** 	"/anonymous@cs.toronto.edu:"

* 	Tex
*** 	ascii2german.sh by dorai@egeria.rice.edu in /public 
 ascii2german converts 
**** 	"/anonymous@titan.rice.edu:"

* 	AMSTeX
** 	AMSTeX
*** 	AMSFonts, AMS-LaTeX, AMSTeX  NOTE: The AMS doesn't alert other 
       archive sites when there are changes to the contents 
       of e-math.ams.com.  Consequently, other sites may be slightly behind.
       Administrative contact for E-MATH:  tech-support@math.ams.com.
**** 	"/anonymous@e-math.ams.com:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	per karl berry's article in TUGboat .. also said 'adobe font names'
**** 	"/anonymous@ftp.cs.umb.edu:"

* 	X-Windows/Tex
** 	AIList/Sun-Spots
*** 	[128.100.1.105] ... Mirrors the clarkson style archives for 
       Canadian users contains pub/TeX/tex-styles
**** 	"/anonymous@ftp.cs.toronto.edu:"

* 	Mailing Lists/Graphics/TeX
** 	MuTeX/Raster Files/Huge Maling List Index (list-of-lists)
*** 	
**** 	"/anonymous@cs.ubc.ca:"

* 	Neuro-Evolution/Speech Recognition
** 	Neuro-Evolution/Speech Recognition
**** 	"/anonymous@cse.ogc.edu:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	v2.1, pub/transfig/fig.tar.Z     Fig is a graphics editor under
xo       SunView.  Its output can be translated via TransFig [qv] into
       Postscript, pic, LaTeX picture envirnoment, PiCTeX, EEPIC, TeXtyl etc.
**** 	"/anonymous@sun.soe.clarkson.edu:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	contains fig under pub/fig. this allows graphic editing which
       can be put in latex by transfig which is also here. and sun.soe.clarkson.edu
**** 	"/anonymous@svax.cs.cornell.edu:"

* 	Tex
** 	ChTex/ArabTeX/Image
*** 	devanagari font from TeX. pub dir
**** 	"/anonymous@rugrcx.rug.nl:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	United Kingdom Chum...X11R5 dist, udda stuph
**** 	"/anonymous@130.88.200.7:"

* 	X-Windows/Tex
** 	ChTex/ArabTeX/Image
*** 	X11R4
**** 	"/anonymous@crl.dec.com:"

* 	TeX
** 	TeX
*** 	TeX related stuph
**** 	"/anonymous@a.cs.uiuc.edu:"

* 	Elisp/Tex
** 	Calendar.el/Diary.el/tree.sty
*** 	tree.sty and home site for Ed Reingold's calendar
**** 	"/anonymous@emr.cs.uiuc.edu:"

* 	Smalltalk Archive
**** 	"/anonymous@st.cs.uiuc.edu:"

* 	Quran
*** 	The login is 'MARK'
the password is 'IPFS'
The type 'ACCT QUOTE IRAN' for read password.
Quran.txt is the text file
desquran.zip is the PC program (includes the compressed version of the text).
**** 	"/anonymous@vmd.cso.uiuc.edu:"

* 	X-Windows
** 	SPHIGS/SRGP
*** 	sphigs and srgp are in pub... for an alternative to xlib
**** 	"/anonymous@128.148.31.66:"

* 	Hypertext
** 	Hyperbole
*** 	
**** 	"/anonymous@wilma.cs.brown.edu:"

* 	Recipes
** 	Recipes
*** 	
**** 	"/anonymous@128.252.135.4:"

* 	Recipes
** 	Recipes
*** 	
**** 	"/anonymous@sulaw.law.su.oz.au:"

* 	Magick/Gifs
** 	ChTex/ArabTeX/Image
*** 	Aleister Crowley GIF's and other magickal items
**** 	"/anonymous@slopoke.mlb.semi.harris.com:"

* 	Parallel Machine
** 	ChTex/ArabTeX/Image
*** 	parallel machine

* 	Parallel Computing
** 	Parallax
*** 	Parts of the book intro to parallel computing by lewis and
el-rewini <prentice-hall, publishers> are available on the server.
also the parallel software is available  
**** 	"/anonymous@lynx.cs.orst.edu:"

* 	FTP Database
** 	Xarchive Standalone
*** 	has an x version non-x version and a perl version. all in the
directory archive/clients  
**** 	"/anonymous@archie.mcgill.ca:"

* 	Parallel Computing
** 	SIMD Simulator
*** 	/pub/blitzen ... email to brain@adm.csc.ncsu.edu
**** 	"/anonymous@mcnc.mcnc.org:"

* 	Parallel Computing
** 	PCN 
*** 	awesome parallel language soon to have C++ compatibility
**** 	"/anonymous@info.mcs.anl.gov:pub/pnc"

* 	ftp
** 	ange-ftp mail archive
*** 	

* 	Parallel Language
** 	Parallel C/Parallel Fortran
*** 	pub/Parallel/Tools/pc.1.1.1.tar.Z
C parallel  fortran is also being developed at Univ. of Houston. Contact
scott@uh.edu for information regarding pf.
J. Eric Townsend - jet@uh.edu - UH Dept of Mathematics
vox: (713) 749-2126  '91 CB750, DoD# 0378, TMRA# 27834
**** 	"/anonymous@karazm.math.uh.edu:"

**	text-to-phoneme/Linguistics/Natural Language Processing
***	There is such a program available by anonymous ftp from
here: ftp.Hawaii.edu.  It is file /pub/linguist/phon.tar.Z.
Greg Lee <lee@uhunix.uhcc.hawaii.edu>


**	Biology/BioBits
***	All of the BioBits are available as a source direct from nic.funet.fi
and are also registered with think.com so you can read them with WAIS
from either place.

You can also get them via anonymous ftp from nic.funet.fi in the directory
/pub/sci/molbio/biobit
   Rob Harper                     /   E-mail:          harper@convex.csc.fi    
   Finnish State Computer Centre  /   Molbio/software: harper@nic.funet.fi
   P.O. Box 40, SF-02101 Espoo    /   Telephone:       +358 0 457 2076
   Finland                        /   Fax:             +358 0 457 2302



*
**	7 wonders of the world/pyramids/babylon/zeus/colossus/artemis
***
Well, there is strong evidence that they did exist, and some even have parts
still lying about.  Here is a play-by-play:

1)  Egyptian pyramids - Obviously still evist.  Erected from about
2650-1800BC.  About 80 still exist.

2) Hanging gardens of Babylon - Not mentioned by Herodotus, but many others
refer to them.  Destroyed by Sennacherib in 689.

3) Statue of Zeus by Phidas (at Olympia) - Was at the sacred grove of Olympis
by 457 BC.  Almost 60 feet tall.  Moved by Theodorus I to Constantinople where
it was burned in 475 AD.

4) Colossus of Rhodes - Designed by Chares of Lindus.  Took 12 years to build
(done in 280 BC).  Destroyed by earthquake in 224BC.  Some of the parts lay
there for 896 years, then were sold to a Jew of Emesa.

5) Temple of Artemis - Is still there (parts of it, at least)  At Ephesus.
Built by the architect Chersiphron in 6th cen BC.  Burned in 356 BC by
Herostratus, rebuilt, destroyed again by Goths in 262 AD.  Fragments are at
the British Museum.
1
6) Mausoleum at Harlicarnassus - Built in 353 BC.  Destroyed by earthquake
before 1400AD.

7) Lighthouse at Alexandria - Erected around 270 BC.  Was the prototype for
all following structures of its kind. I do not know when it was destroyed.

All of these items are considered valid.  There may be a few questions about
the particular facts, but you can bet that they all existed.


*
**	Number systems/ancient science
***
Ever wonder why there are 60 seconds in a minute and 60 minutes in an
hour?  Or why there are 360 degrees in a circle?

The 'sexagesimal' system was used by the Babylonians for astronomical
purposes, and was based on the fact that the sun moves approximately
one degree through the sky each day.

Other common number bases in use today are:

24 - number of hours in a day

16 - number of ounces in a pound
12 - number of pennies in a shilling (well, this used to be common...)
   - number of inches in a foot

The decimal system isn't as intuitive as all that...

You might want to have a look at:

"The Exact Sciences in Antiquity" by O. Neugebauer, 2nd Edition, Dover
Publications, 1969.

Chapter 1, "Numbers", goes into a lot of detail about number systems,
ranging from the Babylonians to the Greeks via the Egyptians.  Arabic
mathematics was largely based on these.


*
**	golf
***
Pat Inglis refers to the Golf Digest article:

>The fact that it was published in the April issue lead me to believe
>that the whole article was a joke! Although most of the shots were
>highly improbable (with the exception of the skipping across water one
>which I have done purely by accident :-)), the article was serious but
>meant to be taken in good fun.

No joke.  Pros actually practise the shot.  I've seen Ken Venturi use it
on his instructional segment on TV.  He explained the necessity of it, showed
what to do, and skipped the ball across the water and up onto the green.  The
ball stopped about 3 feet from the cup.  The film crew and Venturi and 
everybody within range of the mike laughed.  He said something like "It doesn't 
always work out that well."  Pretty amazing.

-stew


*
**	locker
***	31-6-42, locker #21

1) turn clockwise two full rotations and go to first number and stop

2) turn counter-clockwise past second number once and then stop on 2nd number

3) turn clockwise to third number and pull open

*
**	voodoo/ethnobiology
***	
After a brief and boring discourse on the popularity of the word zombie in many
disciplines, Davis offers possible origins of the term. First, Elsie Clews 
suggests that in French the word "ombres" means shadows. Inserting a "z" at the front yields z'ombres. Clews also feebly makes a connection betweeen jumbie,
the West Indian term for ghost and zombie. Maya Deren, an awesome filmmaker 
notes that the beliefs of the Arawak Indians concerning the zemis, or souls of
the dead, "...are precisely those relating to the zombies." (57) However 
according to Davis most scholars "...indicate an African origin for the 
word." (57)

Past the history, Davis notes that death is but an unknown frontier. The 
existence of zombies is for the Haitians proof of the power of the dead
over life. --> Rituals respecting the power of the dead form most of the core
of Haitian Voodoo. Davis then relates three secondhand accounts that he 
heard from a mambo, or Voodoo priestess. 
	1) a child dies. the father of the child seeks the murderer. once he 
finds the murderer, he kills the murderer's daughter. 5 months later. the
first girl is found dead. the police attribute the death to lightning, however,
the girl is not burnt and the child in her arms is alive. the voodoo
explanation is that a death spirit took the girl.

	2) a woman sews a funeral dress for a girl. she is told later by
a bokor (sorceror, magician) that the girl will be raised. The bokor held a
rope between two graves and straddled a third grave. He clapped his hands and
called the girl's name. She appeared from the side of the cemetary. The bokor
intends to make a magical force (pwin) out of the girl.

	3) Mammes owes money. He goes to a houngan (male mambo, a voodoo
priest). The money is sent out from the houngan's house. However, the houngan
takes the soul of Mammes. The former vivacious Mammes is zombie-like. Mammes
has intercourse with a hideous woman with oozing sores. When he awakes, he
wants to know why he sleeps with such an ugly woman. The houngan has died.
The implication is that the houngan sent the woman so that he could reclaim
his soul through sexual intercourse.

Davis says all Haitian zombies can be categorized as either a spirit which a
priestess keeps in a jar to be sent into man or animal or a person who has
been made glassy-eyed and listless because his soul has been stolen. He can 
become normal again by regaining his soul usually at the death of the master.
The second way to regain the soul is if the zombie is fed salt. He flies into
a murderous rage in which he generally kills the person who made him a zombie
first.

Davis says that Zora Neale Hurston, an young American anothropologist, 
suggests the idea that instead of returning from death, the victims are
given drugs which bring on death-like states.

*
**	my words
***

\documentstyle{article}
\setlength{\textwidth}{6.5in}
\setlength{\textheight}{8.5in}
\setlength{\topmargin}{0.0in}
\setlength{\oddsidemargin}{0.0in}
\setlength{\evensidemargin}{0.0in}
\pagestyle{headings}


\title{Three Strikes}
\author{Terrence Monroe Brannon}
\date{25 Aug 1991}
\maketitle
\begin{document}
\baselineskip .25in
\section{}
There was a horrible funk with this woman. She walked toward me and I felt it
rather than smelt it. Had observed her many times from afar, wondered what
business she had around me and those like me. Though she was in the minority,
she walked with a great confidence, a great air of self-satisfaction and it
made me want to crack through---made me want to be what she desired. Couldn't
get a line on her though, never talked to her. Never knew what made her click.
Or what might make her crack.

I knew if I talked to her I could impress her. Drop hints about all my
perversion---common ground between us. She was set up, no doubt. If we were to
talk turkey it would be on her terms and in her muck and mire and stench.

But what did I want with her anyway? Why should I try to satisfy my sick
psyche? Why not rectify it? Even as I ask I feel the urge to feed my
sickness. Feed it slabs and slabs of perverse pleasure. Just once more into
the fire won't hurt. Remember the pleasure with Cecile. Forget the spikes
she drove into your heart at the end. Remember how Lisa loved you? All the
affection, all that sexy body, all night long. Forget how she was fucking 
someone
else the week you broke up. Forget how after you broke up she came by "to say
hi" and put that luscious tongue on you. Put lust in your blood and then
hustled out the door before you could smoke that pussy one last time. Can't
hurt to be a fool one more time. Who said "three strikes and you're out"
anyway?

\end{document}






--

All sex with Ayurvinda was a journey for me. A journey which took me back hundreds of years, to ancient cities. Stone edifices in the deserts of Yucatan. whirling powers would cloud my head and make me seek deeper, sink deeper into her liquid depths- black depths smoother than oil, darker than night. Immersed in such wordless deepness.

Calm snugness when I mold with her. Treasures in the chest down to where she spreads for me, for me for me.

--

\documentstyle{article}

\begin{document}

A ringing sound knifed through the crisp winter night. 
"Why must I be like that . Why must I chase the cat . Nothing but the dog
in me..." - atomic dog by george something-or-the-other.

Black, bald-headed man with feathers looped around his waist and venomous
white juice gushing from his mouth holds dog carcass skyward. Tilts his
head backward and with teeth bared and neck muscles taut screeches 
to the gods. Convulsively, the head is a pendulum as his black silk torso
undulates with a passion. {\em European bystanders never seen such behavior. Not}
\ what they'd call civilized. Heedless the body does work. Circling and
whirling dust fiercely in the air. The tribe is watching letting the
vibrations take them and make them. Rhythm does pound deeply.

deep interest in the sister from El Paso. Spain is VERY close to Africa.
she speaks the spanish with a quickness

On Friday, I saw the most amazing hypnotist. He made a girl speak nonsense
yet had another person comprehend it. 

\end{document}

--

*
**	mexico/occult/quetzalcoatl
***

This is a broad subject. I'm including excerpts from the Introduction
of the book "Quetzalcoatl in Myth, Antropology and Art" by Portillo,
Sodi and Diaz Infante. What you will read below was written by
Demetrio Sodi.

Enjoy:

                                                                          
Numerous authors have studied Quetzalcoatl, one of the most important
pre-Colombian deities, in many different ways. A vast bibliography has
been amassed on the subject, including excellent studies and analyses, as
well as literary re-creations which have sparked great interest in this
most captivating figure, while at the same time causing unfortunate
confusion due to the irregular quality of this type of literature. Above
all, Quetzalcoatl's dualism, his being simultaneously a man and a god,
comprehends his historic as well as religious character in the abstract
manifestation of very ancient concepts that we have been able to unravel
through archeological remains which have allowed us to establish a
fairly complete chronology of ancient Mexico.

The basic idea of this study is to differentiate and clarify the identity
problem which surrounds Quetzalcoatl the god, along with his symbolism,
and Quetzalcoatl the man and his historical activity, shedding light upon
those aspects in which the deity and human reality become one:
Quetzalcoatl the god is the plumed serpent, but he is also and here he
becomes confused with Quetzalcoatl the man) Tlahuizcalpantecuhtli, the
Lord of the Dwelling Place of the Aurora, Venus at dawn, planet which---ac-
cording to myth---is Quetzalcoatl the man, who,  after having set fire
to himself, ascended to the firmament, becoming Venus---his nahual or
alterego being Xolotl, a monstrous dog which symbolizes Venus in her
evening phase. Another fusing of the human with the divine is the
parallelism which exists between the myth of Quetzalcoatl the god and his
enmity toward Tezcatlipoca, and the coin- cidence that the governing
priest, Ce Acatl Topiltzin ends his glorious reign at the hands of the
priests of Tezcatlipoca, who forced him to abandon Tula after having
committed several moral transgressions which he himself had strived to
avoid for humanity's sake. The Quetzalcoatl-Tezcatlipoca conflict appears
in the myth of creation as well as in historical documents, both of which
emerge in the drama of Tula.

The principle of duality which permeates the religion of various
Mesoamerican cultures has much to do with the Quetzalcoatl concept
crystalized in Nahuatl culture. Given the impossibility of taking all the
different cultures into account, we will limit ourselves to analyzing
Quetzalcoatl almost exclusively within the Nahuatl culture, with brief
references to other surrounding areas.

It would seem that the concept of duality crystalizes at the beginning of
the Lower Preclassic period, if not a bit later; that is to say, two
thousand years before Christ. From that time on, certain cultural traits
can be established which make up a common Mesoamerican substratum, and
which later on would appear in line with local' typification and develop-
ment, differently expressed according to each individual culture's
evolution. Dualism is one of the concepts which form part of this common
substratum.

One of this duality's forms of expression was the plumed serpent complex:
the duality earth-air, that which crawls on the ground and that which
flies united in a single concept. Quetzalcoatl is generally known as the
plumed serpent in the Nahuatl areas, and as Kukulcan in the Mayan areas.
Quetzalcoatl can be translated either as the Serpent of Precious Feathers
or as the Precious Twin; both translations are fundamentally important in
the naming of the divinity. Kukulcan only holds the Plumed Serpent
meaning.

Quetzalcoatl-Kukulcan is a perfectly defined deity which reaches its
maximum cultural expression during the Toltec period (tenth to twelfth
century A.D.), but there also exists an archeological complex inspired by
the Plumed Serpent which, in reality, does not symbolize this particular
god. The plumed serpent complex, or the complex of the serpent-bird which
appears during the Preclassic period, is related to the water gods and not
to penitence, creativity, Ometeotl---or the prohibition of human
sacrifice---and Venus in her morning or evening phases as it would later
on in Teotihuacan. Roman Pina-Chan, one of the foremost authorities on the
Preclassic period, has clearly stated that ''At first the agricultural
groups probably considered the aquatic serpent, depicted with a kind of
crest on its head, as the spirit of the waters, with the arrival of the
Olmecs this serpent is attributed certain characteristics of the tiger, or
jaguar, especially the claw which served as a tail, converting this animal
into a mythological or magical creature, similar to the Chinese concept of
the celestial dragon. In one way or another this concept evolves towards
the representations of a plumed or precious serpent that symbolizes the
water which 'winds' or 'runs,' indicating that this phenomenon is
related to inland water, as can be observed in the temple of Quet-
zalcoatl at Teotihuacan.''

It is difficult to determine exactly to what degree the serpent-bird and
earth-water relationship is maintained after the Preclassic period.
Perhaps it turns into an abstract concept following this period,
abandoning a specific affiliation for a complex one with the many other
gods that operate within a cosmovision born of a mythical cosmogony. It is
most lil<ely that it was in Teotihuacan---the quintessential classic
city---on the Central Plateau region, which reaches its climax during
the following period, where it solidified into the already defined aquatic
deity.

Pina-Chan adds:
'The most important Teotihuacan deity was probably Tlaloc, rain god and
god of the celestial waters who was considered as he who fertilizes the
earth and protects earthly goods. This god lived in the high mountains
where the clouds are born, and he is depicted as wearing a mask, blinders,
nose-ring, and as having fangs and a forked serpent tongue.  In other
words, he was a deity with characteristics of both serpent and jaguar.

''Nevertheless, in order to have arrived at the concept and representation
of a god of this nature, there had to be an evolutionary process. It would
seem that the celestial dragon species connected with water which appears
in Tlatilco during the Middle Preclassic period was prior to the plumed
serpent concept that was later followed by the god Tlaloc.''

According to Pina-Chan, therefore, the plumed serpent is no more than
Tlaloc's antecedent, a predecessor of the water god. Nonetheless, Laurette
Sejourne, one of the most outstanding Quetzalcoatl specialists, thinks
differently: "The basis of the Nahuatl culture is founded entirely upon
the religious teachings of Quetzalcoatl, whose spiritual elevation is
comparable to Christ's or Buddha's. And as our era begins with Christ, the
pre-Columbian era began with Quetzalcoatl: they maintained that they lived
in the era of the Plumed Serpent. Stemming from the establishment of this
religion, Mesoamerican art does no more than express the essential
formulas of his doctrine, taking advantage of styles as diverse as the
Romanesque and Gothic, for example.

''Through archeology it has been proved that Teotihuacan, the first great
Mesoamerican city, is dedicated to quetzal-coatl (bird-serpent), which is
the key image of her symbolic language due to the fact that it expresses
the basic concept of the Nahuatl religion. This is an important
clarification because it al lows us to situate the commencement of the
Nahuatl era approximately at the same time that our era began. It is not
entirely impossible that the discovery of a ceremonial center dedicated to
the Plumed Serpent even older than Teotihuacan could push back this date
even further.''

That is to say that---according the Sejoume---the Preclassic serpent-bird
complex (aquatic) evolves in Teotihuacan (Classic) until it becomes
Quetzalcoatl, a deity who begins a whole new era, the Mesoamerican age.

In Teotihuacan, at the pyramid known as the temple of
Quetzalcoatl---within the immense sanctum called the Citadel---the plumed
serpent appears in all its glory, sculpted in polychromatic stone, and
alternating with representations of the water god.  According to the
hypothesis that this is a reminiscence of the Preclassic period, in
Teotihuacan the plumed serpent god is already separate from the water god,
but he continues to be intimately related to him. In this sense, all
evidence points to the idea that Quetzalcoatl, as an individual deity,
crystalizes in Teotihuacan, and that this city is his place of origin. On
the other hand, Quetzalcoatl the god, is also a wind divinity, and goes by
the name of Ehecatl, a deity whose attributes we shall study later on. At
the same time, Quetzalcoatl appears intimately related to various myths
such as that of creation and those of tt-e elements which sustain the
human race: corn, for example, the pre-Columbian food par excellence. This
myth is so important that we could call the Mesoamerican cultures ''corn
civilizations.'' Hordes from the north descend upon the central valleys,
captained by Mixcoatl after the fall of Teotihuacan. These groups are
generically known as the Toltecs.


First they came
to the place called Tollantzinco
[Tulancingo, Hidalgo].
Forthwith they went to Xicocotitlan
to the place called Tollantzinco.
Now no one remembers
how long they traveled.
They came *om the depths of the plains,
*om between the rocks.
There they saw sel/en caves
nd made of these caves their temples
their place of prayer.


After the fall of Teotihuacan, the Toltecs found Culhuacar, and aftelwards
they establish themselves in rula, just as the text narrates. Until
recently there was much confusion over the cities of Tula and Teotihuacan
due to the indigenous and European texts written after the Conquest. Even
today the origin of the Toltecs continues to be an important and
controversial topic. Toltecatl is a Nahuatl word which means ''artist'';
those who were wise and sensitive, those who could create works of great
beauty and perfection, were called toltecatl.  Toltecayotl means
'Toltecness,'' or a ''reunion of the arts and artists.'' In the
Toltecayotl lived the tlacuilo, or the painter, who owned black and red
earth; the zuquichiuqui, or potter, ''taught the clay to lie''; the
amantecatl was the artist of the pen, and there were also other artisans,
builders, and sculptors, all of whom ''put their heart touched by the gods
in their work' (tlayoltehuial1i), as it is said in the texts, and together
they created the concept of excellence with which all things Toltec were
expressed.  For this reason, given the grandeur and artistic wealth of
Teotihuacan, it was thought for many years that this city was the Toltec
capital. But after systematic archeological exploration, it has been
clearly established that Tula Xicotitlan, in the present-day State of
Hidalgo, was the true capital of the Toltecs. It was precisely from these
archeological studies that great confusion arose through the heated
polemics between the experts. How can it be possible that Tula, a
relatively small and poor city---when compared to Teotihuacan---be the
cradle of Toltecayotl, the marvelous world of the arts to which the texts
refer? The answer most surely can be found in a simple play on words and
ideas. The The Toltecs from Tula, semisavage, absorb the remains of the
Teotihuacan culture;s unequa!ed grandeur. Thus, Teotihuacan is most
certainly the capital city of Toltecayotl, or in other words, their
artists and artisans rightly deserved the name of Toltecs.  But those of
Tula, although they could never surpass their Teotihuacan teachers, are
nevertheless great artists and can also be called Toltecs; on the other
hand, they also called themselves Toltecs due to their ethnic
affiliations, and the term was later consecrated through language and
popular use.

There is an indigenous text in which the Aztecs describe their impressions
upon seeing Tula for the first time during their long peregrination
south---a text which makes the Aztecs perhaps the first archeologists of
the Western Hemisphere.

We once again come across Quetzalcoatl in this description, but no longer
as palt of the serpent-bird or plumed-serpent complex. This poem refers to
a real man, posthumous son of Mixcoatl who (according to several
chronicles) was bom in Tepoztlan, and who later traveled to Culhuacan,
where he was called on by the Tula Toltecs to govern them after the
dispersion of the Toltecs from Teotihuacan. Quetzalcoatl accepts the
position, and while developing an extraordillary government, he creates a
new religion for his people, a new concept of life. The real man
corresponds to an abstract and religious concept in such a way that the
Toltecs mythicize him and believe that to him they owe all: their
calendar, corn, even their colored cotton.

This man, priest and statesman who dedicates much of his time to
philosophical and religious meditation, is the figure who would
revolutionize Mesoamerican culture and originate a new era. With the name
of Ce Acatl Topiltzin Quetzalcoatl, ''Our Prince Quetzalcoatl 1 Cane''
(this being his calendar name), Quetzalcoatl---the man---appears, figure
who in texts and chronicles---would be constantly confused with
Quetzalcoatl the god, cultural hero, creator of a theology and of numerous
intellectual achievements to which ''humanity owes its existence." He
preached penitence and completely avoided human sacrifice.

The ideas of Quetzalcoatl are of prime importance in the Mexican people's
history of ideas. The development of the Mesoamerican cultures, the
analysis of theil cosmogony, their cosmovision, and divine numerals, give
us a norm which can be followed in order to understand these ideas.


<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
     ____   ____
    /    \  |   \     Omar Patino-Siliceo       Academic Computing Support
   |      | |    |    Box 1375, Station B       Computer Center
   |      | |__ /     Nashville, TN 37235       Vanderbilt University
    \    /  |  \
   __\  /__ |   \     Tel: (615) 343 1631       ops@vuse.vanderbilt.edu     

<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>



In brief, this was an ancient agricultural deity of a group of late immigrants
to what is now central Mexico.  The identity of the deity was in dynamic flux
throughout the 700 or so years immediately preceding the Spanish conquest,
when these immigrants settled and developed a unique civilization.  Around
1100 AD the deity became identified with one of its foremost priests at the
Toltec capitol of Tollan (it was a common belief among these people that
priests routinely became the embodiment of the deity they served), whose full
name was Ce Acatl Topiltzin Quetzalcoatl (One Reed Revered Leader Precious
Serpent).  It is this individual who is associated with the legend you
mention.  He was the chief priest of Quetzalcoatl at the temple called
Tlahuilazcalpantecuhtli (a temple dedicated to the evening star, Venus). He
was tricked by a rival priest into a drinking bout and associated debauchery
and was publicly disgraced.  He left spouting off assorted mumbo-jumbo and
embarked on the gulf coast toward the east (he seems to really have ended up
in present-day Yucatan).

The deity itself originated as a wind-god, and evolved to be on of the more
important deities in the pantheon of Nahuatl peoples (Uto-Aztecan-Tanoan
stock, related to the greater Athapascan language group that also includes
folks such as Utes and Apaches).  Its associated celestial representation
was Venus and, depending on era and cultural group, there is a specific
color associated with it, as well as a cardinal direction (West).  Other
cultural attributions of the deity are the invention of the sciences, writing,
the calendar and of agriculture.

You have asked a question that many have spent lifetimes dealing with.  For
additional info, I refer you to a very accessible book for non-specialists:

Caso, Alfonso.  The Aztecs, People of the sun.  1958.  Univ. of Oklahoma Press.
(50th Volume of the series: "Civilization of the American Indian."

Read, specifically, pp. 23-27, Complexity of the Aztec Pantheon.

-Ricardo






*	Teach yourself C++ book
**	Al Stevens.  Published by MIS press.  ISBN: 1-55828-176-2

*	wordperfect/market
**	1800-451-5151
	will have offices in singapore and tokyo, japan
	first translations will be to japanese and korean.
	we can submit a proposal with: our org, our current
operations, our plan of action , and would we want to do anything with
an english-only version of the software
	David Pearson , WP Corp., MS a-145, 1555 Technology Way, Orem,
UT 84057 

*	
**	Parallel/Concurrent Smalltalk
***	
Object Technology International (here in Ottawa) have a modified version of
ST V that runs in a multiprocesor environment. I was talking to someone from
a Canadian governmental agency that was using it. It is also apparently
being used by people like the FBI and CIA.

OTI has added an 'Actor' class whose instances run on separate hardware
processors. Obviously they have added some primitives.

This is second hand info; contact OTI for more details. From the phone book,
their address is: 1785 Woodward DR, Ottawa. (613) 228-3535

Good luck.

-- 
Timothy C. Lethbridge             tcl@csi.uottawa.ca
(613) 564-8155                   FAX: (613) 564-9486
Department of Computer Science, University of Ottawa
150 Louis Pasteur,    Ottawa,    Canada      K1N 6N5

*
**	Smalltalk books
***	A list of Smalltalk-relevant texts.  Retrieved from the Digitalk
forum on Compuserve.  If you know of any additional texts, please
let me know.  Thanx.


Ron Schultz                                  
Berard Software Engineering, Inc.            
Columbus Ohio Office                           Headquarters
5634 Claire Court                              301 Lakeforest Drive
Dublin, Ohio 43017                             Gaithersburg, Md. 20877
Phone  (614) 798-0295                          (301) 417-9885  
FAX    (614) 798-0296                          (301) 417-0021


Smalltalk 80 The Language, Adele Goldberg & David Robson
        Addison-Wesley 1989             ISBN 0-201-13688-0

Smalltalk 80 The Interactive Programming Environment, Adele Goldberg
        Addison Wesley 1984             ISBN 0-201-11372-4

Smalltalk 80 Bits of History, Words of Advice , Glenn Krasner
        Addison Wesley 1984             ISBN 0-201-11669-3

Inside Smalltalk Volume I, Wilf Lalonde & John Pugh
        Prentice Hall 1991              ISBN 0-13-468414-1

Inside Smalltalk Volume II, Wilf Lalonde & John Pugh
        Prentice Hall 1991              ISBN 0-13-465964-3

Object-Oriented Graphics, P. Wisskirchen
	Springer-Verlag 1990		ISBN 3-540-52859-8

Practical Smalltalk: Using Smalltalk/V, Dan Shafer and Dean A. Ritz.
        Springer-Verlag                 ISBN 0-387-97394-X

Rapid Prototyping for Object Oriented Systems, Mark Mullen
        Addison Wesley 1990             ISBN 0-201-55024-5

Object-Oriented Design, Peter Coad and Ed Yourdon
	Yourdon Press 1991		ISBN 0-13-630070-7

Object Oriented Programming for Artificial Intelligence, Ernest Tello
        Addison Wesley 1989             ISBN 0-201-09228-x

The Well Tempered Object, Stephen Travis Pope
        MIT Press 1991                  ISBN 0-262-16126-5

RefTalk/Vwin, David Carl O'Neal
        NuVista Press 1991              ISBN pending

Human-Computer Interface Design Guidelines, C. Marlin Brown
        Ablex Publishing 1989           ISBN 0-89391-332-4

Designing Object-Oriented Software,
                Rebecca Wirfs-Brock, Brian Wilkerson, and Lauren Wiener
        Prentice-Hall 1990              ISBN 0-13-629825-7

Object Oriented Programming with Smalltalk/V, Dusko Savic
        Ellis Horwood 1990              ISBN 0-13-040692-9

An Introduction to Object Oriented Programming & Smalltalk
        Lewis Pinson & Richard Wiener
        Addison Wesley 1988             ISBN 0-201-19127-x

SAA Common User Access Advanced Interface Design Guide
        IBM 1989                        IBM Document # SC26-4582-0

IBM Red Books----(available from your IBM representative
                  contact your local office of IBM and request
                  the placing of an IBM Red Book Order.  If you
                  are an IBM customer, the books are free.  If you
                  are not an IBM customer, the books may have a nominal
                  fee.)----

A Practical Introduction to Object Oriented Programming
        IBM 1990                        IBM Document # GG24-3641

Object Oriented Design - A preliminary Approach
        IBM 1990                        IBM Document # GG24-3647

Developing a CUA Workplace Application
        IBM 1990                        IBM Document # GG24-3580-00

Managing the Development of Object Oriented Applications
        IBM 1990                        IBM Document # GG24-3581-00

Object Oriented Analysis of the ITSO Common Scenario
        IBM 1990                        IBM Document # GG24-3566

CUA Evaluation
        IBM 1990                        IBM Document # GG24-3456

SAA CUA '91 Guide
        IBM 1991                        IBM Document # SC34-4289

SAA CUA '91 Reference
        IBM 1991                        IBM Document # SC34-4290

SAA - A Guide for Evaluating Applications
        IBM 1991                        IBM Document # G320-9803

*	
**	Artificial Intelligence/Biology/Gene Structure/Genomic DNA
***
          GENEID ONLINE SYSTEM FOR PREDICTION OF GENE STRUCTURE
                        version 1.0 11/20/1991

Geneid is an Artificial Intelligence system for analyzing vertebrate genomic 
DNA and prediction of exons and gene structure (1). A prototype is 
implemented as a fast, automatic email-response system. 
 
REGISTRATION:
Before or simultaneously with submitting a sequence for analysis, you need to
register your name by sending a line with the word "register", followed by
your name and address. Example:

  register, Don Johnson,  Miami Vice,  Baywiev Marina Dock A12,  Miami, FL 
 34566-1234, U.S.A.

(the line can be longer than 80 characters as long as it contains no 
linebreaks). Send the line in a mail to: geneid@darwin.bu.edu.  The
registration information will only be used for maintaining a file of the 
number and geographic distribution of the users.


SUBMITTING SEQUENCES:
Your sequences must be submitted in the following format (approximately same 
format as used for fasta, BLAST and GRAIL):
You can submit only one sequence per mail. Put the sequence after the 
keyword "Genomic Sequence" as shown below:

Genomic Sequence
>seqname
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC
CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG
GCCAACTCCATCACTA...................

(Remember that long lines get truncated by Mail, so try to keep the lines 
below 80 characters. The seqname is limited to 20 characters). If your mail does not contain the keyword "Genomic Sequence", or any other keywords listed in this file, no mail will be returned to you.
If the reply file with the results will exceed the Mail limit of 300 kB, the 
reply will be split into several files.
On a UNIX system you could send the File containing the sequence as follows:
mail -v geneid@darwin.bu.edu  <File


LIMITS:
GeneId currently will not accept sequences smaller than 100 bp or larger 
than 20 kb.


CONFIDENTIALITY:
Your submitted sequence will be deleted automatically immediately after
reception by GeneID.


ANALYSIS:
GeneID will scan your sequence for potential splice sites, startcodons, and 
stopcodons. Then it will try to assemble these into potential first exons, 
internal exons, and last exons. Exons will be evaluated according to a number 
of characteristics related to coding and splicing, and only likely exons will 
be kept. Mutually exchangeable exons (normally overlapping and in the same 
frame) will be put together in classes. Only the top 15 ranking first and
last exon classes, and the top 35 ranking internal exon classes 
from each sequence will be kept, and assembled into potential gene models with
open reading frame, that will be ranked according to quality of the exons 
they contain. The top 20 models will be included in the return mail. Your 
return mail will also contain lists of the sites and exons created during the 
analysis. GeneID will not analyze the reverse complement of your sequence. If 
you suspect a gene on the other strand, submit the reverse complement 
sequence separately.


TIPS FOR USE OF GENEID:
GeneID will try to identify first, internal, and last exons in each of the
sequences you submit, and try to assemble these into models of ONE likely
gene in each sequence. To avoid missing any exons, the number of exons will
be vastly overpredicted, and only a few of them are likely to be true (they 
tend to be the top ranking exons, but a few true exons rank very low). But
these few true exons are likely to be found in the gene models because they
fit together to form a continuous open reading frame. Thus you should look to
the gene models to find a probable coding region.
If you submit a sequence that turns out to contain two genes, the behavior of
GeneID is unpredictable. It could either predict one large gene containing 
both, or it could predict only the gene with the most typical charateristics.
If you submit a sequence that contains only part of a gene, GeneID will try to
identify an entire gene in this sequence. Thus the predicted first exon may 
actually be part of a true internal exon, or the predicted last exon may be 
part of a true internal exon. If GeneID fails to predict any genes, you might
look at the potential exon lists.
Thus you can experiment with input and response, by starting out with 
sequences that are not too long (for example less than 10 kb), and see if
GeneID is able to extend the gene if you extend the sequence.
GeneID will not construct models with more than 22 exons.
If the sequence contains frameshift errors in exons, then that may affect 
the quality of the prediction in the current implementation.

ACCURACY:
In a test on 28 genes from GenBank, 91% of the nucleotides were correctly 
predicted as coding or non-coding. Since these two categories are unequally 
represented, a better measure of accuracy may be the correlation coefficient, 
which was found to be 0.68. See paper for details.

ANALYSIS TIME:
Will depend on the load on the system and grows approximately linearly with
the length of the sequence input. Expect at least 1 minute per kb. Longer
response times can occur if the system is temporarily down (check with the 
UNIX command: "finger geneid@darwin.bu.edu").

FURTHER INFORMATION:
A preprint of a paper describing the development and testing of GeneID is
available as a Stuffit.hqx file for Macintosh. Simply include the line:
  
  Preprint Request

in your mail to geneid@darwin.bu.edu, and the manuscript will be mailed to 
you.


REFERENCING:
Publication of output from GeneID must be referenced as follows:
(1) Guigo, R., Knudsen, S., Drake, N., and Smith, T. (1991) Prediction of 
Gene Structure. Submitted manuscript.


PROBLEMS, COMMENTS, AND SUGGESTIONS:
Can be mailed to klose@darwin.bu.edu.

Users of the MBCRR and BMERC national computer resources have direct 
online access from their account. Contact Tom Graf at tom@mbcrr.harvard.edu
for information on these accounts.

---------------------------------------
Biomolecular Engineering Research Center
Boston University
-- 
Domain: curtiss@umiacs.umd.edu		     Phillip Curtiss
  UUCP:	uunet!mimsy!curtiss		UMIACS - Univ. of Maryland
 Phone:	+1-301-405-6710			  College Park, Md 20742

*
**	TeX book
***
Let me put in a plug for what I think is the best *learning* book
for TeX at the moment:

  A Beginner's Book of TeX
  Raymond Seroul and Silvio Levy
  Springer Verlag 1991

Although it does have a Dictionary/Index, this is mainly 
a learning book for the beginner. I found it very well-written.
It contains a lot of information in a clear way.

*
**	c++ book
***
Try Keith Weiskamp and Bryan Flamig's The Complete C++ Primer.

This is a book that was written specifically for the C programmer
who wants to write C++ code. It also has enough C references
that somebody who doesn't remember all of C can get by.

The book was recommended to me by a very good hacker and I've
just started reading it.

Its Academic Press, ISBN 0-12-73.C153W45 (1989)

*
**	c++ book
***
Try Keith Weiskamp and Bryan Flamig's The Complete C++ Primer.

This is a book that was written specifically for the C programmer
who wants to write C++ code. It also has enough C references
that somebody who doesn't remember all of C can get by.

The book was recommended to me by a very good hacker and I've
just started reading it.

Its Academic Press, ISBN 0-12-73.C153W45 (1989)

*	pcn/definitional variables/mutable variables/data checks
**
Actually, the swap example on p.17 of "Parallel Programming with PCN"
is correct as it is.  I suspect what happened is that you ran it from
the PCN shell with the command:

	swap:swaptest(1,2)

This will, in fact, produce an incorrect answer.  However, this is not
because the swap program is wrong, but because you are calling a
procedure that expects mutable arguments with definitional arguments.

More specificly, the problem is that the 'swap:swaptest(1,2)' call
from the PCN shell is passing definitional variables for i and j.  But
the swaptest() procedure is expecting i and j to be mutable variables.
Since swaptest() is expecting mutable variables, it does not do data
checks on the variables.

If you wish to run swaptest() from the PCN shell (or call it with
definitional arguments), then you need to wrap a procedure around it
that does the conversion from definitional arguments to mutable
arguments.  For example:

defn_swaptest(i,j)
     int m_i, m_j;
{;
    m_i := i,
    m_j := j,
    swaptest(m_i, m_j)
}

Either that, or you can change i and j to be definitional arguments in
swaptest() and swap().

However, this technicality is certainly not obvious in the "Parallel
Programming with PCN" example.  It took me a couple minutes of staring
at it to see that this was the problem.  Thank you for pointing it
out, so that in a future version of the manual we can make this
example more clear.

-Steve



*	unix programming/c programming/networks/tcp/ip/sockets/ipc
**
Advanced UNIX Programming, Rochkind, 265p., Prentice Hall, 1985
Covers file and terminal I/O, processes, IPC, signals, system calls etc.

UNIX Network Programming, Stevens, 772p. Prentice Hall, 1990
Lots of socket source code

Internetworking with TCP/IP, Douglas Comer, 2 Vol., Prentice Hall, 1991.
*	biology
**
 HC/CRYSTAL      180      2/1/92    BinHex4.0,Compact1.3.2
 /mac/etc/chemistry/crystaltutordemo.cpt.hqx
 
               A set of seven stacks illustrating the basic ideas
               of solid state structure and geometry.
 
 HC/GENBANK      207      2/1/92    BinHex4.0,Stuffit1.5.1 
 /mac/etc/biology/genbanksearch.sit.hqx
 
               A tool for interacting with computer services at
               Genbank, a molecular biology database at 
               Stanford.  You need MacTCP and a valid e-mail 
               address.
 
 HC/ENZYMEKIN    108      2/1/92    BinHex4.0,Stuffit1.5.1
 /mac/etc/biology/enzymekinetics1.0c.sit.hqx
 
               Plots velocity vs substance concentration,
               Linewaver-Burk, Eadie-Hofster.  Stores it's
               plots in the clipboard as PICTs.
 
 HC/TIMEZONES     35      2/1/92    BinHex4.0 
 /mac/etc/production/ustimezones2.0.hqx
 
               Do you call people in other time zones around the
               country?  The map in this stack displays times in
               different places of the U.S.  Select an area 
               code and it'll give you the zone and the time
               (includes Canada, Alaska and Hawaii)
 
 DEMO/GCK        807      2/2/92    BinHex4.0,Compact1.3.2
 /mac/etc/biology/geneconstkitdemo1.06.cpt.hqx
 
               Thorough looking program which includes tutorial
               and extensive on-line help.  DNA Construction
               and create lists of enzymes.
 
 UT/LWTOOLS      536        2/2/92    BinHex4.0,Compact1.3.2 
 /mac/utilities/print/dmmlwstuff1.1.cpt.hqx
 
              A set of templates for altering and removing a lot of the
              different resources from the System 7.0 laserwriter driver.
              It allows removal of the Truetype resource, as well as a lot
              of others.  Includes N-Up chooser goodie that allows
              you to save paper by printing documents "N-Up" (such as
              two pages to one physical sheet).  Postscript tools
              also.  Even the Unadobe and Readobe utilities. 
 
 GA/EMPIRE       339      2/2/92   BinHex4.0,Compact1.3.2
 /mac/games/war/empiremaster2.01.cpt.hqx
 
               The idea here is to conquer the world & wipe your
               opponent's (in this case, the mac) military.  Based
               on the Vax "Empire" game, you conquer cities
               and expand.  Eventually, you run into the computer's
               territory.  V  2.01
 
 DEMO/BEYOND     333      2/2/92    BinHex4.0,Compact1.3.2
 /mac/etc/demo/drtsbeyonddemo2.06.cpt.hqx
 
               Got a MIDI Input device and a musical keyboard? 
               This is a demo version of a Midi Editor with
               some neato advanced composition tools.  Includes
               sample songs for you to try out. 
 
 CO/FIRSTCLAS    255      2/2/92    BinHex4.0,StuffitDeluxe
 /mac/utilities/communications/firstclassuser1.65.sit.hqx
 
               A client application which will allow you to hook
               up (via AppleTalk or modem) to First Class 
               Bulletin Board systems.
 
 GA/ATAXX         57      2/2/92    BinHex4.0,Compact1.3.2
 /mac/games/board/ataxx1.01.cpt.hqx
 
               Playing with either another player, or the mac,
               this game's object is to end up with the
               most pieces.  Reminds me of Othello.  V 1.01
 
 FO/CASLON        56      2/2/92    BinHex4.0,Compact1.3.2
 /mac/system.extensions/font/type.one.fonts/caslonswash.cpt.hqx
 
               Size: 24.  A Type I font of classic looking
               serifed script.  Upper/lower case.
 
 FO/CHAMPION      45      2/2/92    BinHex4.0,Compact1.3.2
 /mac/system.extensions/font/type.one.fonts/champion.cpt.hqx
 HC/GELFRAG      173      2/2/92    BinHex4.0,Stuffit1.5.1
 /mac/etc/biology/gelfragsizer1.4.sit.hqx
 
               Designed to take some of the tedium out of 
               estimating sizes (molecular weights) of DNA/RNA
               fragments in experiments and provide an accurate
               estimate.
 
 UT/SPKQUENCH    156      2/2/92    BinHex4.0,Compact1.3.2
 /mac/etc/biology/speakquencher1.4.cpt.hqx
 
               Uses sound manager to read DNA sequences to user
               through the Mac's speaker.
 
 FO/SHOCK         77      2/2/92    BinHex4.0,Compact1.3.2
 /mac/system.extensions/font/type.one.fonts/shockfont.cpt.hqx
 
               Size:  24 & 48
               Type one font where the lower case letters are
               all caps of zapped, quirky letters.
 
 UT/TESTPAT       77      2/2/92    BinHex4.0,Compact1.3.2
 /mac/utilities/developerhelps/testpat


* 	Z Sites
**** 	"/anonymous@cs.umn.edu:"
**** 	"/anonymous@sirius.ucs.adelaide.edu.au:"
**** 	"/anonymous@kampi.hut.fi:"
**** 	"/anonymous@garbo.uwasa.fi:"
**** 	"/anonymous@ousrvr.oulu.fi:"
**** 	"/anonymous@tukki.jyu.fi:"
**** 	"/anonymous@tolsun.oulu.fi:"
**** 	"/anonymous@ftp.nisc.sri.com:"
**** 	"/anonymous@scam.berkeley.edu:"
**** 	"/anonymous@peace.waikato.ac.nz:"
**** 	"/anonymous@cs.orst.edu:"
**** 	"/anonymous@louie.udel.edu:"
**** 	"/anonymous@nic.nyser.net:"
**** 	"/anonymous@jaguar.utah.edu:"
**** 	"/anonymous@alf.uib.no:"
**** 	"/anonymous@hemuli.tik.vtt.fi:"
**** 	"/anonymous@sunic.sunet.se:"
**** 	"/anonymous@chem.bu.edu:"
**** 	"/anonymous@itstd.sri.com:"
**** 	"/anonymous@genbank.bio.net:"
**** 	"/anonymous@rdss.ucar.edu:"

<(Return to Top Level)>				C-c C-s to show the full entry
<(Cut Out All But Topic Headers)>		C-c C-h hide the subentries
<(Frequent FTP Sites)>				C-h m for extensive help
<(Top of File)>